Explain how genetic information is transferred from DNA to RNA to proteins.
Part B. Short Answer (5 points each)
Check your essay before you submit. See exactly what your professor sees.
See your AI and plagiarism results before your instructor does.Get the exact same report your professor uses. Trusted by 50,000+ students worldwide.
Answer the questions below as completely and as thoroughly as possible and where appropriate include a specific example to illustrate. Answer the question in essay form (not as an outline or as bullets) using complete sentences. Cite sources of information you used to answer the questions or that support your answer.
- Explain how genetic information is transferred from DNA to RNA to proteins. Include the terms DNA replication, transcription, translation, the principal events and enzymes. Use the following DNA molecule to illustrate each stage.
3′ TACTAGCCACATCTACCGATC 5′ Template strand used for transcription
5′ ATGATCGGTGTAGATGGCTAG 3′ Coding (“inactive” strand)
- An electron micrograph shows a structure with a rigid outer wall, amembrane, ribosomes, a nonmembrane bound nuclear area, and no endoplasmic reticulum or mitochondria. Explain why the structure is or is noteach of the following: a human T cell, a virus, a bacterial cell, a yeast cell.
- Describe the difference between an emerging and a re-emerging disease and give a recent example of a viral or a bacterial infection of each and explain the reason for that classification.
- Name the four types of acquired immunity and describe the mechanisms by which a person acquires the immunity (“how it is conferred”). In a table describe the following characteristics for each them: type of immunizing agent (antibodies or antigen), relative time for immunity to appear, relative time the immunity lasts, and the source of antibodies (for example, self or non-self) that act against a pathogen or other antigen
Welcome to one of the most trusted essay writing services with track record among students. We specialize in connecting students in need of high-quality essay writing help with skilled writers who can deliver just that. Explore the ratings of our essay writers and choose the one that best aligns with your requirements. When you rely on our online essay writing service, rest assured that you will receive a top-notch, plagiarism-free A-level paper. Our experienced professionals write each paper from scratch, carefully following your instructions. Request a paper from us and experience 100% originality.
From stress to success – hire a pro essay writer!
